circad | circRNAs associated with diseases

circ-NT5C2/hsa_circ_0092509
Gene	NT5C2	Organism	Human
Genome Locus	chr10:104850367-104850753:-	Build	hg19
Disease	Osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	29383123
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	52 pairs of osteosarcoma tissue and normal paracancerous tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AGTCCTAAGTTTTCCACTTCA Reverse AGGTGCCAGTAGCATTTTAGAC	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Liu, X, Zhong, Y, Li, J, Shan, A (2017). Circular RNA circ-NT5C2 acts as an oncogene in osteosarcoma proliferation and metastasis through targeting miR-448. Oncotarget, 8, 70:114829-114838.